rs11242626 chr5:107104878 G>C
- Sequence
gacactgctgacacctggctgaca[G/C]catgactataaccttgtgagcgac
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.67 | 1.29 | 1.00 | |||
| foreskin keratinocyte | 1.41 | -3.50 | 2.33 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.24 | -0.29 | 1.00 |
Items per page:
1 – 3 of 3