rs112473439 chr6:32692049 A>T
- Sequence
tcttgttttcttctgttcttggtt[A/T]taattctaagatggtctgacaagt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | n/a | 1.09 | 1.50 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -2.69 | 1.53 | 1.50 |
Items per page:
1 – 2 of 2