rs11250292 chr10:127953 T>A
- Sequence
tggaaaattaacaccaggcttcac[T/A]ggagaagcgggactgcggactgac
- ASB in cell types
- fetal bone marrow-derived mononuclear cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal bone marrow-derived mononuclear cells | 2.25 | -1.90 | 1.50 |
Items per page:
1 – 1 of 1