rs112502960 chr17:49361940 G>A
- Sequence
ggccgcctccgcctccgccgcccc[G/A]gccgccgcctcggcggtccatccc
- ASB in cell types
- HCT-116 (colon carcinoma) MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 0.20 | 0.90 | 1.97 | |||
| MV-4-11 (Childhood acute monocytic leukemia) | 1.28 | -0.26 | 1.10 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Muscle_Skeletal, Pancreas, Thyroid, Whole_Blood