rs11252782 chr10:4857478 A>G
- Sequence
cctccctctttcccatctgccatg[A/G]ttgtaagtttcctgaagcttcccc
- ASB for transcription factors
- ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | 3.41 | -0.44 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis