rs11255178 chr10:7523754 T>C
- Sequence
cgttcacaactttacattggaaac[T/C]gtagagttatgactcgtgtgtgat
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.82 | -0.83 | 1.00 | |||
| K562 (myelogenous leukemia) | 2.26 | 0.09 | 2.00 |
Items per page:
1 – 2 of 2