rs11260681 chr1:5744518 G>A
- Sequence
ggaattcagagaagccagaggtca[G/A]agtgagcccccagctctgcttcca
- ASB in cell types
- iPS-derived dermal fibroblasts
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -2.24 | 2.67 | 1.00 | 1.48 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
