rs112947658 chr22:23180482 T>G
- Sequence
tccgtcatccgcgccgcggccacc[T/G]ccccccggccctccccttcctgcg
- ASB in cell types
- foreskin keratinocyte 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.26 | -0.91 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.85 | 0.34 | 1.39 | 0.00 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood