rs112991646 chr19:43188204 G>C
- Sequence
tggcatcccctgggaaggctccag[G/C]ctgggagggactctgtcgtcctct
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) KMS-11 (Plasma cell myeloma) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 0.86 | -0.20 | 1.67 | |||
| KMS-11 (Plasma cell myeloma) | 2.03 | n/a | 1.33 | |||
| Kelly (neuroblastoma) | 1.57 | -1.11 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood