rs1131727 chr9:5832728 G>C
- Sequence
gtcgaactccccgcggtgtccagc[G/C]gccccgcgtagcacgagctgctgc
- ASB in cell types
- transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| transverse colon | 2.46 | -2.49 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid