rs113445910 chr7:95511906 A>G
- Sequence
gtgctgccttccctttgctacttt[A/G]gagtcctgccgctaatgtaaatta
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.01 | 0.85 | 1.96 | |||
| foreskin keratinocyte | 0.50 | n/a | 2.67 |
Items per page:
1 – 2 of 2