rs113722835 chr3:16884328 C>A
- Sequence
tcatacccggccgcccctgcccgc[C/A]gtgggcttcctctcggcgccgcgg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.14 | -1.14 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1