rs114087632 chr7:51162916 A>G
- Sequence
gacatagaaacagccagcaggggg[A/G]gcaccaataaagccaatactcact
- ASB in cell types
- HMEC (human mammary epithelial cells) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.58 | -0.64 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.93 | 0.23 | 1.17 | -2.14 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
