rs1141328 chr2:233060456 G>A
- Sequence
ggtcctgggggtgcctgccggccc[G/A]gccgaggaggcccacgcccaccat
- ASB in cell types
- monocyte-derived dendritic cells MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | -1.94 | 2.72 | 2.00 | |||
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 1.79 | -0.70 | 1.00 |
Items per page:
1 – 2 of 2