rs114166337 chr20:5126664 A>T
- Sequence
cccattggctaatcgcacactgaa[A/T]cgcacgccttttcccgcccctgac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.58 | 0.19 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Thyroid