rs114620830 chr17:6853734 G>C
- Sequence
tatttaaaaaaatattttgagaga[G/C]ggcccacagaccctctgaaagaag
- ASB in cell types
- GM17942 (lymphoblastoid cell) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 3.59 | -3.73 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.23 | 1.68 | 1.00 |
Items per page:
1 – 2 of 2