rs1147227 chr5:32852766 G>A
- Sequence
gtgagctggactaacttgcctttc[G/A]tttcatccatttccacctccagtg
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte FT282 (normal human fallopian tube tissue)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.99 | -0.81 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.62 | -0.49 | 1.12 | |||
| foreskin keratinocyte | -1.25 | 1.67 | 2.00 | |||
| FT282 (normal human fallopian tube tissue) | -0.93 | 1.63 | 1.00 | |||
| upper lobe of left lung | 2.06 | n/a | 1.00 |
Items per page:
1 – 5 of 5