rs1147377 chr9:129484130 G>T
- Sequence
tttagcccctacctgggatctgag[G/T]gagcacccatccttggaatgcagg
- ASB in cell types
- BEAS-2B (bronchial epithelium) keratinocytes
- ASB for transcription factors
- GCR_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -0.36 | 1.44 | 1.00 | n/a | No Hit | |||
| SNAI2_HUMAN | 2.37 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, college completion, fasting blood glucose, fasting insulin, homa-ir, infant head circumference, tetrology of fallot
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood