rs11489780 chr1:15950058 C>T
- Sequence
tctctcaatgacattcctaaatgg[C/T]tgtggctagagccctaagtgtaag
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) monocytes from periferal blood hTERT-HME1(Telomerase immortalized cell line)
- ASB for transcription factors
- TCF21_HUMAN SRBP2_HUMAN BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.86 | n/a | 3.00 | n/a | n/a | |||
| SRBP2_HUMAN | 2.28 | n/a | 3.00 | n/a | No Hit | |||
| BRCA2_HUMAN | -1.61 | 1.80 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid