rs1150360 chr11:95778896 A>G
- Sequence
taagtgacatcacttcttctttca[A/G]ttgacttataaggacaaaattgtc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SRF_HUMAN MEIS2_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | -0.46 | 1.70 | 1.00 | -1.06 | Weak Discordant | |||
| MEIS2_HUMAN | -5.01 | 2.92 | 2.00 | n/a | No Hit | |||
| MEF2B_HUMAN | -1.29 | 2.02 | 1.67 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence, ldl cholesterol, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood