rs11514193 chr12:57646122 T>C
- Sequence
cagagaggatttattttaaaaaac[T/C]tttttttttttttcttttttgaga
- ASB in cell types
- VCaP (prostate carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.40 | -0.43 | 1.00 | |||
| HEK293 (embryonic kidney) | -0.19 | 0.86 | 1.98 |
Items per page:
1 – 2 of 2