rs11575815 chr3:46378679 A>T
- Sequence
tgccggcaccatcccagttgtgaa[A/T]aagaggtatttccacagcggctca
- ASB in cell types
- thyroid gland pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | -2.56 | 2.48 | 1.00 | |||
| pancreas | -0.64 | 1.63 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood