rs11576939 chr1:85276329 G>C
- Sequence
cacttcagtgaggtcctcctcggt[G/C]agggacggtgcggtgggctccatg
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia) HepG2 (hepatoblastoma) HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- CDK9_HUMAN HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | 0.37 | 2.57 | 1.00 | n/a | n/a | |||
| HIF1A_HUMAN | 2.01 | 0.10 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood