rs11586313 chr1:152917994 G>A
- Sequence
cagttacattctgaaagccagtag[G/A]tggagacccaggagaactgatggt
- ASB in cell types
- pancreas epithelial cell of prostate GM18486 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.18 | 0.41 | 1.83 | -0.50 | Weak Concordant | |||
| STAG1_HUMAN | 2.83 | -0.17 | 2.11 | n/a | n/a | |||
| RAD21_HUMAN | 1.98 | -0.58 | 1.71 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, cystatin c in serum, eye color, ldl cholesterol, prop taste detection threshold, pulse pressure, rheumatoid arthritis
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis