rs11596745 chr10:44932894 G>A
- Sequence
caccagggggcaccagtgagccat[G/A]gcagtccagcctgcgagcataaga
- ASB in cell types
- MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) HUVEC-C (HUVEC, umbilical vein endothelial cells) adult erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | 1.29 | 0.39 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.45 | -0.93 | 1.00 | |||
| adult erythroblasts | 2.52 | n/a | 4.00 |
Items per page:
1 – 3 of 3