rs115975731 chr2:88831873 G>A
- Sequence
tgtcctggctgcatggggccagca[G/A]ggggcgatccagtctagcacaagg
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.58 | -4.21 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood