rs115985581 chr5:95858966 T>A
- Sequence
ccagggaggtcggttgatgagcag[T/A]cgggaagtgggtctgcgcgcaccc
- ASB in cell types
- CD34+ stem cells-derived erythroblasts GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.35 | -1.58 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.20 | 0.36 | 1.00 |
Items per page:
1 – 2 of 2