rs11614790 chr12:581014 G>A
- Sequence
gtgcatatgtctgtgtgaatgtgt[G/A]tgttcatgtcttgtgtatgtgtct
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.52 | 0.05 | 2.04 |
Items per page:
1 – 1 of 1