rs11626409 chr14:96189730 T>G
- Sequence
gtgagggggaaggcagacgcagtg[T/G]gagcagtccagtaacttatctgga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.13 | 0.23 | 1.09 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, chronic kidney disease, fasting blood glucose, neuroblastoma (brain cancer), serum creatinine, urinary albumin-to-creatinine ratio