rs11632388 chr15:86235780 G>A
- Sequence
aacatgagtgactttgccccagag[G/A]gagcaattagcaaggtctggagac
- ASB in cell types
- CLB-Ga (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CLB-Ga (neuroblastoma) | 1.98 | -1.25 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, waist hip ratio