rs11632762 chr15:55743123 G>A
- Sequence
cggacggccgctcgcgagaagcaa[G/A]gggcctgagagtccggctgggggc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.08 | 1.08 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Nucleus_accumbens_basal_ganglia, Colon_Transverse, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Ovary, Thyroid