rs11647053 chr16:87203341 G>A
- Sequence
aacggaactcgaggataaaccgtc[G/A]ccaggcccaggcctggccactggg
- ASB in cell types
- upper lobe of left lung GM18486 (Lymphoblastoid Cell Lines) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 1.17 | -0.37 | 1.12 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.27 | -2.94 | 1.33 | |||
| pancreas | 1.28 | 0.57 | 1.12 |
Items per page:
1 – 3 of 3