rs11659654 chr18:58781719 C>T
- Sequence
actgatgctcgagactcagcgggg[C/T]ctttgcacgtgaatagccaccagg
- ASB in cell types
- HEK293 (embryonic kidney) KMS-11 (Plasma cell myeloma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.50 | 1.11 | 2.51 | |||
| KMS-11 (Plasma cell myeloma) | -2.17 | 0.62 | 2.50 | |||
| HeLa (cervical adenocarcinoma) | 0.91 | -3.14 | 2.00 |
Items per page:
1 – 3 of 3