rs11662171 chr18:42114464 C>G
- Sequence
gctgatggcagtttaaatgtcttc[C/G]cagaagccattcagctaattgttg
- ASB in cell types
- glioblastoma cells GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 0.10 | 2.27 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.70 | 0.59 | 1.05 | |||
| MS-1 (Small cell lung carcinoma) | 0.56 | -0.18 | 1.00 | |||
| foreskin keratinocyte | 0.48 | n/a | 3.00 | |||
| hASC (preadipocytes) | 1.56 | 0.52 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Brain_Cortex, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid