rs11662909 chr18:49548499 G>A
- Sequence
agaggaaggagacagaggtgctag[G/A]aggcagggcaggggttgccatttt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.17 | 0.12 | 2.59 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, fasting insulin, hdl cholesterol, total cholesterol, triglycerides