rs11669445 chr19:15971435 C>G
- Sequence
agaaggtggaacagcagcaacttt[C/G]atcattgccgccgagaatgcaaaa
- ASB in cell types
- right lobe of liver 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| right lobe of liver | 2.65 | n/a | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 2.77 | -5.29 | 2.00 |
Items per page:
1 – 2 of 2