rs11671848 chr19:48259983 C>T
- Sequence
agacttttagtacttttactaatt[C/T]tgctactgctatctagagggcgga
- ASB in cell types
- HEK293 (embryonic kidney) SEM (childhood B acute lymphoblastic leukemia) GM19239 (male B-cells lymphoblastoid cell line) PC9 (lung adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN ERG_HUMAN JUN_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.74 | 0.25 | 1.04 | n/a | No Hit | |||
| ERG_HUMAN | 3.57 | -5.04 | 1.33 | n/a | No Hit | |||
| JUN_HUMAN | 2.27 | -2.20 | 1.33 | n/a | No Hit | |||
| STAG1_HUMAN | 0.90 | 0.14 | 1.00 | n/a | n/a | |||
| PRDM1_HUMAN | 2.74 | -5.07 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood