rs11677710 chr2:232365747 G>C
- Sequence
ctgcccgatctggggccatgctgc[G/C]tcctgctggccacactgcaaaatg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) Peyer's patch upper lobe of left lung esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.10 | 2.33 | 1.43 | 7.34 | Concordant | |||
| STAG1_HUMAN | n/a | 2.46 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
