rs11682175 chr2:57760458 T>C
- Sequence
aaacctatctcgtttttcaccatg[T/C]atttactttagggcaggttatttt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.34 | 0.76 | 1.14 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI autism spectrum disorder or schizophrenia, depression, irritable mood, schizophrenia, sleep duration
GRASP alzheimers disease, bipolar disorder, body mass index (bmi), hip bone mineral density (bmd), late onset alzheimers disease, ldl cholesterol, schizophrenia, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, total cholesterol, years of education