rs11683997 chr2:31067508 A>G
- Sequence
tttgtgccggcagagggtgcactc[A/G]ctcaggaaagcagggtctgctcag
- ASB in cell types
- NB69 (neuroblastoma) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NB69 (neuroblastoma) | n/a | 3.27 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | n/a | 2.25 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, sporadic creutzfeldt-jakob disease, triglycerides