rs11690153 chr2:127081958 T>C
- Sequence
acggaggcaggatgcacaccctcg[T/C]gccccggcgttctcacaccgaggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | n/a | 3.10 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1