rs116974412 chr7:156909133 G>A
- Sequence
ctcactgcgccaggccgggccacc[G/A]tgcagaacgcgcgcggatctcaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- PAX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX2_HUMAN | -0.36 | 2.09 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid