rs117341962 chr17:82914505 T>C
- Sequence
ctgtgtctgcaccatgagtgtgtt[T/C]gctggagtgcggtgtttgcactcc
- ASB in cell types
- thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | -3.41 | 1.86 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood