rs117426293 chr12:119989101 G>A
- Sequence
gtcgctgaggagacccgcgagccg[G/A]cgaatcccgcgcgggcggggcgaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- RBM25_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 2.38 | -1.98 | 1.50 | n/a | n/a | |||
| ANDR_HUMAN | 2.15 | -0.61 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Hypothalamus, Colon_Transverse, Nerve_Tibial, Pancreas, Stomach, Testis, Whole_Blood