rs117471372 chr8:97775112 C>T
- Sequence
agtaattgagctgtgaagcggaga[C/T]aaattgctctcggtggtggttcaa
- ASB in cell types
- TF-1 (erythroleukemia)
- ASB for transcription factors
- GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | -1.04 | 3.06 | 2.00 | 6.16 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
