rs117472413 chr21:42188403 C>T
- Sequence
agtgtatttcctgtgatcaagtca[C/T]acagcctaggctgcaacagcgaga
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood fetal bone marrow-derived mononuclear cells
- ASB for transcription factors
- SPI1_HUMAN KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 3.20 | 0.45 | 1.50 | n/a | No Hit | |||
| KMT2A_HUMAN | 2.44 | -2.02 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2