rs11756362 chr6:152338679 A>C
- Sequence
caaatgtgtttcatggaagagttt[A/C]aggctgcagtggcagcagccggga
- ASB in cell types
- K562 (myelogenous leukemia) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.67 | 0.32 | 1.10 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 0.63 | -0.43 | 1.00 |
Items per page:
1 – 2 of 2