rs11764238 chr7:150877417 C>T
- Sequence
ttgttgaagaactagggaattgtt[C/T]taattctgcagattagtctcttct
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) neural cell K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.88 | 2.13 | 1.00 | |||
| neural cell | -1.31 | 1.79 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.09 | 0.42 | 1.49 | |||
| HEK293 (embryonic kidney) | 0.85 | -0.21 | 1.96 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -1.44 | 1.82 | 1.00 |
Items per page:
1 – 5 of 5