rs11769186 chr7:154913715 A>G
- Sequence
ttcccaagcagcggaaactcttag[A/G]tcggcctccgcgtctgagaacaga
- ASB in cell types
- VCaP (prostate carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 0.97 | -0.97 | 1.00 | |||
| foreskin keratinocyte | 0.76 | -2.81 | 2.00 |
Items per page:
1 – 2 of 2