rs11782034 chr8:38714439 T>A
- Sequence
catggacgcccatcactaaccagc[T/A]agtggtccaaatgcgtccgatgtc
- ASB in cell types
- K562 (myelogenous leukemia) HMEC (human mammary epithelial cells) HBMEC (human brain microvascular endothelial cells) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.14 | 0.47 | 1.44 | 2.50 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
